Quantification of gp350/220 Epstein–Barr Virus (EBV) mRNA by Real-Time Reverse Transcription-PCR in EBV-Associated Diseases
2004
Quantification of the Epstein–Barr (EBV) DNA genome by quantitative real-time PCR has been useful for the management of EBV-associated diseases (1)(2)(3)(4). Nevertheless, it gives no information on the various patterns of expression of the latent genes or on the presence of a lytic infection. EBV lytic mRNAs have been detected in infectious mononucleosis and some EBV-associated malignancies, but their relevance is still debated (5)(6)(7). The quantification of late EBV transcripts may bring additional information to EBV DNA quantification for the understanding and follow-up of EBV-associated disease, as already demonstrated for other herpes viruses (8)(9)(10)(11).
In this study, we developed a method for quantifying a late transcript of the highly conserved EBV envelope glycoprotein gene, gp350/220 (12)(13), that uses real-time reverse transcription-PCR (RT-PCR), the Taqman® technology, and serial dilutions of in vitro transcripts to quantify mRNA. gp350/220 mRNA was quantified in EBV-infected cell lines and was then applied to a series of clinical samples.
Total RNA from cell lines (500 000 cells), clinical samples, or in vitro transcripts (5 μL) was extracted with the High-Pure-RNA-Isolation-Kit® (Roche), and residual DNA was removed by two 20-min incubations with DNase I. The RNA concentration was estimated spectrophotometrically and converted to copy number for the in vitro transcript.
The RT-PCR mixture (20 μL) contained 100 ng of total RNA from cell lines or 250 ng of total RNA from clinical samples, 3.25 mM manganese acetate (LightCycler-RNA-Master-Hybridization-Probes-Kit®; Roche), 0.3 μM upstream primer [gpU2; 5′-AGAATCTGGGCTGGGACGTT-3′; position 89585 (14)], 0.3 μM downstream primer (gpL2; 5′-ACATGGAGCCCGGACAAGT-3′; position 89784), and 0.3 μM probe [EBVGPq; 5′-(6-FAM)AGCCCACCACAGATTACGGCGGT(TAMRA)(Phosphate)-3′, where 6-FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine; position 89761]. The RT-PCR program (61 °C for 30 min, 3 min at 95 °C, and 40 …
Keywords:
- Correction
- Source
- Cite
- Save
- Machine Reading By IdeaReader
28
References
8
Citations
NaN
KQI