Zika virus loop-mediated isothermal amplification detection kit and using method

The invention discloses a loop-mediated isothermal amplification kit for detecting Zika viruses and a using method of the kit. The kit is characterized by consisting of a Zika virus envelop protein (E) gene loop-mediated isothermal amplification primer mixed solution, a loop-mediated isothermal amplification reaction pre-mixed solution, a Zika virus E gene positive quality control and a Zika virus E gene negative quality control, and the kit is applicable to the rapid detection of the Zika viruses. The Zika virus E gene loop-mediated isothermal amplification primer group comprises a pair of outer primers (5'-3' sequences are shown as: AAGCACTGGCTGGTTCAC and TCCAGAGCTCCAGCAAGG), a pair of inner primers (5'-3' sequences are shown as: GTGGAGTTCCGGTGTCTGCCAAGGAGTGGTTCCACGACAT and AGAGTTCAAGGACGCACATGCCTGCTCCTTCTTGACTCCCTA) and a pair of loop primers (5'-3' sequences are shown as: CAGCGTGCCAAGGTAATGGA and AAAAGGCAAACTGTCGTGGT). The using method of the kit is characterized in that the real-time rapid diagnosis of the Zika viruses can be achieved by virtue of an isothermal amplification fluorescent detection system. The method is strong in specificity and high in sensitivity; therefore, a convenient and rapid way is provided for the prevention and control of the Zika viruses and for conducing trend investigation and analysis.